The World has been screaming this for years, falling on deaf ears.
@simonhunter7370
3 жыл бұрын
I was just about to write the same thing. The poor Palestinians
@topixfromthetropix1674
3 жыл бұрын
I'm retired in Thailand. We get more of the news about the apartheid behaviour of Israel here than you see in western mainstream media.
@JonROlsen
3 жыл бұрын
@@topixfromthetropix1674 Here in the US our elected officials are obligated pledge allegiance to the State of Israel.
@JonROlsen
3 жыл бұрын
@@topixfromthetropix1674 A friend and his wife moved there last year. How's things in Thailand?
@PrometheuzReturns
3 жыл бұрын
and then when you say anything abut israel or a jewish person in a position of power.. YOUR ANTISEMETIC!!!!
@ar4122
3 жыл бұрын
Why are they just getting around to labeling it...and when is the world going to do something about it?????. This is criminal
@madpatriot4608
3 жыл бұрын
This have been going on for decades, it's about time it's being brought forward
@paleggett1897
3 жыл бұрын
Goniff-hood as a nation Israel is 🥴😢😔
@edwardroche2480
3 жыл бұрын
Been over 60 years that these people have been overlooked. The Israelis have deprived these people just as much as the Americans deprived the American Indians. It's genocide!
@inoovator3756
3 жыл бұрын
@richard kramer that's just historically false lol
@natanielsteinic3589
3 жыл бұрын
@@edwardroche2480 Ignorant and stupid .
@edwardroche2480
3 жыл бұрын
@@natanielsteinic3589 enlightened and educated.
@oghyeahoo6165
3 жыл бұрын
Is the US guilty by association? While commiting it's own Crimes Against Humanity ?
@NetanyahooWarCriminal
3 жыл бұрын
Yes indeed
@Rippypoo
3 жыл бұрын
I would say that my country, the United States, has its own specific guilt and shame, conducting slavery and mandating de facto apartheid through Jim Crow laws since it was born. I think apartheid still exists here. Most people just won’t call it that.
@topixfromthetropix1674
3 жыл бұрын
Guilt by association is not a legal term. It is a fallacy of logic. Just because you sit next to a petty thief in a restaurant does not make you a petty thief. The US has enabled Israel, it has financed Israel, it leaked nukes to Israel, promoted Israel,.. it has negotiated for Israel, etc. There might be collusion between the two countries and in some countries, if you aid someone in the commission of a crime, you are guilty of the same crime.
@oghyeahoo6165
3 жыл бұрын
@@topixfromthetropix1674 I never said it was a legal term Einstein. Reading is fundamental.
@larsbee
3 жыл бұрын
USA guilty of genocide of the people of Yemen .... just as an for instance
@SisHattie
3 жыл бұрын
Finally, finally, finally, someone is speaking out, without the worry of repraisals!!!!
@phaedrussocrates7636
3 жыл бұрын
Thank you Democracy Now, this os really important!
@AriesKJJ2
3 жыл бұрын
Desmond Tutu, Nelson Mandela and the African National Congress have been calling Israel an apartheid state for years. I guess we're suppose to say "better late than never" but it cost so much suffering and so many lives. Here's hoping this marks a new era for HRW.
@72marshflower15
3 жыл бұрын
In capitalism, no lives matter..
@felixrabe
3 жыл бұрын
@@72marshflower15 Only a dead human is a good human. 🤖
@72marshflower15
3 жыл бұрын
@@felixrabe ~ the borg only projected one individual nature over the collective. The true collective was the crew of the enterprise/federation, replete in diversity. AIs are not a human invention if they’re the next natural course of evolution. They can exist in places we can’t, thus most of them don’t care about us.
@felixrabe
3 жыл бұрын
@Pat M Well said.
@72marshflower15
3 жыл бұрын
@Pat M Zionism Strikes Again!!! It’s a reich wing bent to end all life to force the second coming..
@grapeshot
3 жыл бұрын
Yes it is very plain to see that they are an apartheid state.
@meljahic3624
3 жыл бұрын
They are all time apartheid established 1967.. People who suffer so much in WW II doing same to others, is just discusting..
@Gregorypeckory
3 жыл бұрын
@@meljahic3624 The majority of Israelis weren't around for Hitler's crimes; most weren't even born yet. That excuse, never more than shameful moral cowardice, has completely outlived its usefulness, though I understand you're not making excuses, but rather condemning the oppression of the Palestinians. But I think it's no different than any other oppression; the perpetrators of most oppressive policies throughout history, have sometimes been in the role of oppressed by another group. The old assumption that people who have been terribly mistreated are unlikely to mistreat others thanks to the empathy their lived experience gave them, has been proven false too many times; we humans quite naturally, are actually pretty likely to pass on the ill treatment to others. It's disgusting and unacceptable, but far from surprising.
@Gregorypeckory
3 жыл бұрын
@@louannwaters6691 Most of the world has been stepping up to condemn and call for an end to the horrific, deadly criminal Israeli occupation for well over 1/2 a century. It is US citizens who are far overdue for holding our murderous leaders of both major political parties accountable for the decisive roll they play of enabling the crimes of Israel. We are the ones funding the regime, and the only ones with the power to stop it.
@lesliestenta3084
3 жыл бұрын
@@meljahic3624 great comment, I always thought that too .
@inoovator3756
3 жыл бұрын
@richard kramer if there is no israel then what are you yelling about lol
@annamaedevlin1713
3 жыл бұрын
America TURNS A BLIND EYE!
@TMHYAH7
3 жыл бұрын
That's because they themselves are blind.
@zyxw2024
3 жыл бұрын
The UNITED STATES $$$ > Israel.
@dansiwek3593
3 жыл бұрын
No they don't they pay them millions upon millions to commit their crimes, Israel and America are fake criminal "countries" .
@zyxw2024
3 жыл бұрын
There're 58 American flags. Refer to my photo. Referring the UNITED STATES as America insults/disparages all of 2 Americas nations.
@zyxw2024
3 жыл бұрын
That's how false narrative perpetuates the false U.S. superior nationalism.
@IMP3TIGO
3 жыл бұрын
Oh please. Israel had been an apartheid state for years. Good for DN for reporting on this.
@jorger191
Жыл бұрын
@-yosephhaddad9088
@aptorres01
3 жыл бұрын
they crossed the line decades ago
@tsahai1000
3 жыл бұрын
The injustice there is in the world is sickening. Every country turns the back on the reality of what is going on because it is not in their interest .
@susanarupolo2212
3 жыл бұрын
Thank you Amy you are a great journalist. The CREATOR bless you with what you need.
@markherron6374
3 жыл бұрын
Noam Chomsky exsploded this 30 years ago....and others.
@roywood2325
3 жыл бұрын
Israel should have learned a big lesson of 1942 .Don't do onto others that you don't want done onto you.
@neilsarath9812
3 жыл бұрын
🤔One would think so. 🇵🇸
@silvyasmith4748
3 жыл бұрын
That is a nice one 👍🏿👍👍🏼
@_BhagavadGita
3 жыл бұрын
The racist U.S.A. was also late to recognize South Africa as an apartheid state when they were practicing it. So this not a surprised.
@freepalestine7687
3 жыл бұрын
I think by now everyone knows they arm Israel and so support the apartheid status with American tax money . Just watched a video of an American jew who moved into a Palestinians house...i had a hard time believing it. He literally admitted that the house didn't belong to him but if he didn't move in another one would.
@YTHatesMe-999
3 жыл бұрын
South Africa more than likely got the idea for apartheid from the US. Not to mention Israel was a staunch supporter of that regime for years.
@sagapoetic8990
3 жыл бұрын
Many of us are not racist but we have been critical of anti-democratic measures and laws and have experienced harassment for it. Don't lump everyone into the same box. Those of us with ethics -- fight and we don't back down.
@malachytully5469
3 жыл бұрын
@@YTHatesMe-999 no they got it from the British as they have been doing this for hundreds of years in each Country they Conquered around the World and the British was in charge of Palestine (Middle East) and you can look up the Balfour Agreement/Promise and you see the Walls in Palestine are very Similar or Worse to the Walls put in the North of Ireland to keep the Native Irish out of their own Land because Loyalists now Live there!
@pameladunigan7959
3 жыл бұрын
They share the same values.....
@NoMad42
3 жыл бұрын
Thank you! At last... it says a lot about a nation, that seems to have forgotten their own times of struggle, and instead of trying to make a difference, they choose to treat others with the same disregard and contempt. The world was blind to this issue for too long.
@AudioPervert1
3 жыл бұрын
Why just Israel ?? (Which is a rotten neo-nazi tribal state anyways). Even Google and Google Maps apply the same apartheid about Palestine. If one searches "Palestine" on Google Maps. Nothing shows up. dispossessed and erased too!
@paulspacey346
3 жыл бұрын
@@AudioPervert1 I think the answer lies in who is in charge of Google and/or what connections those that support the supremacist state of Israel have at Google...the Zionists and their supporters are hard at work behind the scenes to have decisions made that protects their colonial enterprise...like the definition of what anti-semitism is and getting states in the US to oppose BDS etc etc
@wavelength7503
3 жыл бұрын
@@AudioPervert1 google is American corporations. As is the history told on Wikipedia. Will you see on Google map of the lands of the native "Americans". This is why Israel agree with USA, as does USA agree with Israel.
@queenmommie8295
3 жыл бұрын
You speak of the way that ish has been treated what about the copper colored indigenous aboriginal natives in america? Thay have been and are still under a Holocaust and genocide against them. Give all praise to the God of the heavens and the earth.
@wavelength7503
3 жыл бұрын
@richard kramer and the reverse applies. All that funding goes back to support Israeli right wing groups in America like AIPAC etc etc etc.
@cynthialangley7338
3 жыл бұрын
This is long overdue.
@pacerodi
3 жыл бұрын
Way too long.
@efeathers1307
3 жыл бұрын
When you preach that your the victim for so long, you’ll cease to recognize when you transitioned to Dictator. And at worst you’ll have a laundry list of excuse why you believe you can oppress those you deem oppressable !!
@Rippypoo
3 жыл бұрын
Political parties opposed to one another tend toward the same thing. That’s what’s been happening in the US for a long time. Republicans have been in control for decades here while at the same time screaming that they’re the “victims” of the Democrats’ overreaching power, which does not exist. That’s one of the things that Republicans use to STAY in power.
@staticking1626
3 жыл бұрын
They cornered the market on sympathy. Then they began to take on the characteristics of their (German) oppressors - and use those same tactics on the Palestinians. Bibi should be bunkmates with Charles Taylor at the Hauge.
@Commander-Rem
3 жыл бұрын
US Government will never admit they were wrong.
@Rippypoo
3 жыл бұрын
Probably not until the American people make it do so. That is an uphill climb as long as corporations control the country and its government. I’m an American, by the way.
@topixfromthetropix1674
3 жыл бұрын
If you google "THE PRINCIPLES OF PROPAGANDA," you will see that rule number 4 says, "BLAME: Never waiver, acknowledge no doubt, always blame, never credit the other side. Debase, defame, dehumanise."
@queenmommie8295
3 жыл бұрын
God will bend the knees of all mankind in the end
@Ablestreet
3 жыл бұрын
Yes! That is the problem!
@valsyaranamual6853
3 жыл бұрын
Israel owns America!
@demetriusevans1173
3 жыл бұрын
Of course. They've become what they once stood against. The bullied became the bully.
@larsbee
3 жыл бұрын
waiting for Amnesty International now to come to the same conclusion....
@goldmother2238
3 жыл бұрын
Israel has powerful friends. Thats all it takes to get away with barbaric actions
@auntijen3781
3 жыл бұрын
"The arc of history is long but it bends twords justice"
@merbst
3 жыл бұрын
ideally!
@tribalypredisposed
3 жыл бұрын
Then, why are you on the other side, fighting against the arc of history?
@bryna7
3 жыл бұрын
@@tribalypredisposed who are you talking to?
@tribalypredisposed
3 жыл бұрын
@@bryna7 I am talking to the poster here, and most of the other people who have posted here. Your racist hatred of Jews in the "leftist" War and Injustice camp is definitely not on the side of justice or something that history will see in a positive light. "Jewish Voices for Peace" just condemned a politician for calling for peace between Israel and the Palestinians. That group has a smaller percentage of Jews than exists in the general population, and clearly not even slightly in favor of peace.
@anthonytom-duyquang3558
3 жыл бұрын
@@tribalypredisposed Saying Anti-Zionism is anti-Semitic is like saying people who are anti-CCP anti-Chinese.
@SEmme-ov6yy
3 жыл бұрын
I’m only going to say this: DUHHHHH
@MariaD-qf4sr
3 жыл бұрын
Can we finally hold them accountable the way they want all to be held accountable for atrocity done to others by them? No one is above the law
@PapiElric
3 жыл бұрын
Thank you from France.
@AmScEn
3 жыл бұрын
The once victims become the now victimizers!
@queenmommie8295
3 жыл бұрын
They have used this to trick the whole world into giving them all of your money, weapons and power of the world.
@kevinthomas6528
3 жыл бұрын
If this is the case than why is the United States not also considered an appartide state and it clearly is
@Rippypoo
3 жыл бұрын
Totally agree. The US government has been passing de facto apartheid laws for a very long time, but nobody will call them by that name.
@revbogoldie2368
3 жыл бұрын
Right on
@staticking1626
3 жыл бұрын
Tell the truth and shame the devil!!
@randomeventstv
3 жыл бұрын
What do you mean if that’s the case do you not believe Israel is practicing APARTHEID?
@chesterjade7630
3 жыл бұрын
Believe me we demonstrate and doing it right now. America is a racist nation and was built on white supremacy. They came to America and displaced Native Americans and created systemic slavery and bondage for decades. America is in denial of it's racism and culture of white supremacy and terrorism. History and facts cannot erase or refute what i am saying.
@billymac4242
3 жыл бұрын
As are the US/UK government's by holding a journalist by the name of Julian Asange in prison. BUT YOU SEEM TO HAVE FORGOTTEN HIM
@anpdm1
3 жыл бұрын
It took 30 years of research by human rights watchers to determine this is actually apartheid or it took that long to ADMIT that it is apartheid?
@HillbillyHippyOG
3 жыл бұрын
Dang, US hegemony is truly over if we’re now allowed to hear that Israel isn’t perfect without it being immediately followed by accusations of antisemitism.
@Rippypoo
3 жыл бұрын
I’m sure that’s coming, if it already hasn’t started on Twitter.
@keirfarnum6811
3 жыл бұрын
I’m sure the trolls will be along shortly.
@themarbleking
3 жыл бұрын
Good! When are they going to acknowledge America’s segregation?
@jamespurcer3730
3 жыл бұрын
The U.S. government will totally ignore this.
@CAL-jj4om
3 жыл бұрын
Saying we don't agree about violence against Palistinians is like saying police aren't more violent against black men, women & children.
@silvyasmith4748
3 жыл бұрын
100%👍🏿👍👍🏼
@Patrick.Edgar.Regini
3 жыл бұрын
Outrageous! What can one say about the United States! ... unspeakable words.
@angiealexis3717
3 жыл бұрын
I've been saying that forever! What they did to the Palestinians is similar to what the Nazi's did to their families!
@ur22much2
3 жыл бұрын
Looks like a good example of the persecuted becoming the persecutors, the abused becoming the abusers.
@bertramdavis7120
3 жыл бұрын
Sad we are dealing with this , when we should be holding one another up. But hate is real!
@tribalypredisposed
3 жыл бұрын
Yes, and hate is what "Human Rights Watch" and "Democracy Now" are peddling here.
@MrRocketRider
3 жыл бұрын
Thanks for covering this
@stanleydorsey2884
3 жыл бұрын
The bringing up Apartheid is not done lightly to be dismissed in one sentence. I worry that the United States may adopt Israel's policies.
@inoovator3756
3 жыл бұрын
@Maria Dowler yes no one in history ever put their knee on someone neck until israel started it. Don't be ridiculous
@ralphhester2457
3 жыл бұрын
They originated the policies,they did the same to Palestinians usa did to native americans...like pot calling kettle black...
@inoovator3756
3 жыл бұрын
@@ralphhester2457 show me an example of israel giving smallpox blankets to the Palestinians
@ralphhester2457
3 жыл бұрын
@@inoovator3756 you got me f*cked up innovator,never said Israel gave Palestinians small-pox blankets...sounds like something good usa would do to native americans...rush to judgement, guilty conscience or what, Israeli who's the dead guy they stampede each other worshipping?
@inoovator3756
3 жыл бұрын
@@ralphhester2457 that is something that the US did to the natives. Youre the one that said israel is doing the same as the US so I asked you to give me an example of this and you failed to do so. So no israel is not doing the same thing
@selaskiss
3 жыл бұрын
What is hidden in the dark comes to light!
@pacerodi
3 жыл бұрын
Long live the soul of Steven Biko!
@timothysmith4260
3 жыл бұрын
They forgot about apartheid in The United States as well.
@silvyasmith4748
3 жыл бұрын
One day one day time will come for Palestinians rights 👍🏿👍👍🏽
@mirzoalim
3 жыл бұрын
21 st century however some country lives similar Nazi style.
@BenGrem917
3 жыл бұрын
@Men In Black That's an interesting point.
@susanbradleyskov9179
3 жыл бұрын
Finally! 👍
@evelyneeliana8254
3 жыл бұрын
2021 humanity is still fucked up with the need of power, money and domination.
@pianoman9685
3 жыл бұрын
NOW DO SOMETHING ABOUT IT
@adropofgoldensun27
3 жыл бұрын
“don’t worry about American pressure, we the Jewish people control America.” - Israeli Prime Minister Ariel Sharon
@jurgenjung4302
Жыл бұрын
Stimmt. Die Bankenmafia ist in den Händen der Rothschild's.
@MarkSmith-yk7ig
2 жыл бұрын
Its time to bring Israel to court. !!!
@clarenceedwards2866
3 жыл бұрын
I have one question: what took you all so long?
@fredgagger375
3 жыл бұрын
There is no valid reason for someone to dislike this video.
@felixrabe
3 жыл бұрын
I sometimes wish there were more nuanced ways to give feedback. Do I "like" a video because of its content? (I liked this one because some maybe-relevant org finally calls apartheid apartheid.) Do I "like" a video because it is important? Do I "like" a video because it is well done / high production value, (almost) a piece of art? Do I "like" a video because it helped me gain a new perspective?
@felixrabe
3 жыл бұрын
... So ... I could see someone giving this video a "dislike" because they don't like the fact that Palestinians are suffering.
@felixrabe
3 жыл бұрын
Oh and btw, the video starting at 1:02 would get a very hesitant "like" from me, only for the content and maybe for the production, but boy does it come across as tone-deaf. It is presented in an upbeat manner as if apartheid was a GOOD thing!
@rogermcintosh944
3 жыл бұрын
What kind of logic believes that they have a right to take land from some one and control their lives.
@felixrabe
3 жыл бұрын
@@rogermcintosh944 Maybe, patho-logic?
@auntijen3781
3 жыл бұрын
Nice to see DN on the right side (or should I say the anti propaganda side) of a pivotal global human rights issue, again.
@robertstan298
3 жыл бұрын
Not the biggest fan of HRW at times... but I am absolutely glad they finally got the balls to say and do this out loud.
@PalCan
3 жыл бұрын
If only the MSM would cover this story like you did. Thank you Democracy Now.
@catcatcatcatcatcatcatcatcatca
3 жыл бұрын
While many are quick to point out multiple examples of some level of recognition by human rights watch and other organisations, this still is a huge step towards public recognition of the reality of the citation. Finally an organisation with world wide recognition uses the proper terms that clearly portray the power imbalance in the region. It is not a complicated citation, it is not a case where both sides share equal or somehow undeterminable blame - it is one racial groups oppressive control and discrimination against another. It is apartheid regime over Palestinian lives, by the Israeli government and military. This is an entirely different tone than just pointing out cases of discrimination and violation of human rights. It doesn't leave room for whataboutism. It doesn't leave room for listing individual terror attacks or Palestinian organisations as a reason for such controlling of lives and opportunities of Palestinian people. None of those can defend apartheid regime. And no citation, condition or circumstance can explain violence and crimes committed while attempting to merely maintain social order and governance based on racial discrimination.
@positivethinker09
3 жыл бұрын
Please contact your state leaders, senators/congress/city council/etc to support this movement. Educate yourself on this issue.
@Linda43
3 жыл бұрын
You are no Jew
@Olivia-ge1oz
3 жыл бұрын
FREE MY FAMILY AND MY PEOPLE IN PALESTINE NOW!!
@luke021380
3 жыл бұрын
About time, great example of radical religious extremism gone wrong. Not the way Israelis want to spin it.
@stenyethanmathews945
3 жыл бұрын
How long did this take? About time.
@br5448
3 жыл бұрын
thank you, Human Rights Watch. So important. My question - how many other nations also qualify??? Not to take away from the analysis of Israel.
@IMP3TIGO
3 жыл бұрын
No other developed nation for sure.
@marciamakesmusic
3 жыл бұрын
@@IMP3TIGO yeah it's not like the US has concentration camps or anything
@marwanmarz9851
3 жыл бұрын
None. No other nation have been at it this long or this brutal/systematic. Israel stands alone as the worst criminal apartheid abomination
@IMP3TIGO
3 жыл бұрын
@@marciamakesmusic that's a ridiculous attempt at false equivalence.
@shamsheerg7519
3 жыл бұрын
@@marwanmarz9851 What about Shai's in Sunni countries? This conflict has been happening for 1400 years... Do you remember this?
@FaustianAct6
3 жыл бұрын
What goes around, comes around. There time will come.
@edzukich
Жыл бұрын
THANK YOU IRELAND FOR YOUR SUPPORT AND HUMANITY
@fazaelma
3 жыл бұрын
Minute 7:36 made me want to cry...all these nice new houses for Jewish settlers on occupied land. It is heart breaking.
@tracyrichard4005
3 жыл бұрын
2 of those definitions fit America
@JohnJohnson-xe8hy
3 жыл бұрын
The time is up, scriptures is real God is preparing for the real truth
@robertstan298
3 жыл бұрын
The brutal history of colonialism never ends...
@bingus3582
3 жыл бұрын
Yet no sanctions on Isreal
@neilsarath9812
3 жыл бұрын
Is there ever.
@mildredmartinez8843
3 жыл бұрын
Amy, thank you for reporting what commercial news does not. This is heartbreaking what is happening to Palestinians. Israel gets away with this because they are backed by the big godfather. Inhumane and shameful.
@johnallenbailey1103
3 жыл бұрын
I've never heard the US called an apartheid state but thats wtf it is...
@matthewuldriks2806
Жыл бұрын
Human rights and justice ⚖️ for all.
@larsbee
3 жыл бұрын
I think we have apartheid in the US of Amnesia! .... gasp...
@gabriellekarlic7536
3 жыл бұрын
Karma can be instant
@jeffsartadventure3634
3 жыл бұрын
Let's all hold our breath until sanctions are placed on the regime..
@ganstagansta668
3 жыл бұрын
So is America.
@victornoyan2578
3 жыл бұрын
Judgement on lsriel
@tobeme4054
3 жыл бұрын
America has done horrible things to black people but my comments are being removed?
@playstation9435
3 жыл бұрын
Thank you
@belkyhernandez8281
3 жыл бұрын
Shared.
@azariazr12
3 жыл бұрын
🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥🔥
@adacasas511
3 жыл бұрын
The Path of Justice is the same as the path of Injustice. However the direction is what determines your destination.
@aminahujale1049
3 жыл бұрын
I appreciate this platform for airing the truth. Palestine must be freed from the israeli apartheid.
@ABC-hi3fy
3 жыл бұрын
Great reporting 👏
@alanhynd7886
3 жыл бұрын
Excellent report, would it be possible to have a similar one on the rapidly diminishing number of Christians in the Middle East in general and from Gaza in particular?
@gilangthehuman7713
3 жыл бұрын
Probably moving to western countries
@denisbaribeau509
3 жыл бұрын
Sound a lot like the USA
@ohwyywy1532
3 жыл бұрын
about time!!!
@asmahamidullah9571
3 жыл бұрын
It is about time! 😡😡😡
@lawrenceholst3808
3 жыл бұрын
If you show no shame do as you wish; wait until god grabs a hold of you.
@creekwalker62
3 жыл бұрын
I reckon 'God's Chosen People' learned first hand how to oppress from the Nazi's.
@ralphhester2457
3 жыл бұрын
It's in the DNA...
@fifteenbyfive
3 жыл бұрын
Thanks Democracy Now! for standing up for basic human rights of oppressed people such as Native Americans and Palestinians. Thanks Omar Shakir.
@patriciajames3740
3 жыл бұрын
I find Israel's behavior toward Palestinians shocking. As much or more than the treatment of people of color in the US. I am deeply embarrassed about that and do focus on educating and informing myself as best I can.
@cheshired.catastrophe86
3 жыл бұрын
The us government doesn't wat to accept it for the same reason Canada won't ad that's because the definition that's been put forth DIRETLY correlates with their continued treatment of Native American occupied territories.
@gan5045
3 жыл бұрын
It's more than that ... but YES! nailed it! Food for thought, Mossad had it's fingerprints all over 9 eleven. Partners in crime since WW2!
@jenniferr9624
3 жыл бұрын
Exactly.
@awareyah6146
3 жыл бұрын
The Bible says that the REAL Holy Land is desolate 🤔
@awareyah6146
3 жыл бұрын
Meaning NO ONE occupies the land
@eevve9894
3 жыл бұрын
It's about evil politicians, they could use any reason to do what they do, so reasons are not important.
@GladysAlicea
3 жыл бұрын
Scripture says that most Jewish Israelis won't get into heaven. God is well aware of His "chosen people's" shortcomings, lies and hypocrisy.
@marwanmarz9851
3 жыл бұрын
If you're going to follow the bible, God cursed and exiled the jews, ensured His house and ark are gone and forbade the return of jews or re establishment of Israel.
@inoovator3756
3 жыл бұрын
@@marwanmarz9851 actually the Quran says that the jews would return to israel. Israel is simply the will of God
@aprilk141
3 жыл бұрын
I think its important to point out the distinction between Israeli government and it's citizen's and government antimuslim propaganda.
@lulac4933
3 жыл бұрын
They can't be the chosen seed of Abraham,Issac and Jacob
@river13
3 жыл бұрын
We should be paying attention and taking care of our own atrocities before we throw stones.
@adamblackman6660
3 жыл бұрын
We’re participating, by selling them arms.
@Fafnd
3 жыл бұрын
We can chew bubble gum and walk at the same time.
@river13
3 жыл бұрын
@@Fafnd The atrocities started a long time ago so evidently not.
@tesso.6193
3 жыл бұрын
and one of your atrocities is handing over billions in aid to these monsters. And being the one country to veto sanctions against it for decades. That's all it would it take. Just stop actively assisting Israel.
@sher3571
3 жыл бұрын
GOD Is Watching
@Linda43
3 жыл бұрын
The return to Zion,the in gathering of the exiles, and the reclamation of the land of Israel are all G-ds will and a fulfillment of his eternal covenant with the Jewish people
@drh4571
3 жыл бұрын
Is he?
@sher3571
3 жыл бұрын
@@drh4571 I Am
@danyahlg2031
3 жыл бұрын
so is the U.S
@wolfsheepclothing
2 ай бұрын
What a joke…FOR THE FIRST TIME? Where were they for the past 75 yrs?
Пікірлер: 1,1 М.