We humans have been practicing science for hundreds of years. Thousands of beneficial technologies have changed the way we live. Unfortunately, too few scientific pursuits have lead directly to improving the human metabolism. We are all subject to hundreds of ailments, diseases, and metabolic defects. With the science of Genomics, we now have the chance to greatly improve upon human biology, help to prevent dozens of deadly diseases, and the relieve the suffering of millions.
@AltafHussain-rr3yg
4 жыл бұрын
Hello could you please tell me which software do you use for these animations
@WTFbrownie
12 жыл бұрын
It is the same thing as computer programming/packet sniffing. In computing, you have a byte, which is consisted of 8 bits. Each bytes can be a letter like "A" or "Z". Same method applies in genes. A gene contains a code for a protein or a unknown code consisted of codes of ACTG. Compile that code and then you have a scripture how the human/animal/plant i built. Same with computers, compile your binary code and you have a program.
@fadimalouf9876
6 жыл бұрын
Good point...
@swarnavasamanta2628
Жыл бұрын
That is exactly why DNA codification so massively complex, far more than computers. Computers only act on 0 and 1, binary coding. But DNA is of 4 building blocks, so it carries more dense information and also more complex.
@maximumquake1
7 жыл бұрын
I still have no idea what genomics is.....
@DavidWu-i3b
6 ай бұрын
1:31
@Nate3145-zt8rh
2 ай бұрын
Lol. No one does, if we did we would live in a utopia(maybe)
@smackalligator
2 жыл бұрын
found this very useful. thanks
@rhysman0001
11 жыл бұрын
is there any websites that show you the human genome? plz tell me if there are.
@GarryRose-m7f
Жыл бұрын
can someone provide the proper citation for this video APA 7 format?
@shiweanyswami7371
Жыл бұрын
Thank you!
@MrWalo1990
3 жыл бұрын
Here, after the Ark Invest results in 2020 from Genomics funds.
@fadimalouf9876
6 жыл бұрын
Great illustration of Genomics. Thanks!
@MeanMachineRex
12 жыл бұрын
Hi there, I think there's a mistake on the visual of two copies of genes in the copy number variation section. The two copies should be on the chromosome and its pair not on the same chromosome.
@chrisfranz
11 жыл бұрын
GATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAAC i ran out of room...
@devononiel
4 жыл бұрын
OMG you know me so well!
@broytingaravsol
7 жыл бұрын
even for the surfacial curvature of bodies?
@toshikitaya2029
7 жыл бұрын
I think there might be a grammatical mistake about 1:28, "the cell that houses it TWO factors outside..." shouldn't it be "to" instead of "two"?
@dabble4609
7 жыл бұрын
h
@osslayer8976
5 жыл бұрын
He never made a mistake
@sawairagul251
2 жыл бұрын
Well explained 🥰💜🥰💃
@mohanagrawal2378
9 жыл бұрын
very useful to me..
@s1zzel
13 жыл бұрын
Very nice! THX
@Hshsuiiien
13 жыл бұрын
very nice, thanks!
@evanstafford55
11 жыл бұрын
I'd love to see an actual human genome mapping.
@hazetechs7141
3 жыл бұрын
Bngo
@theyang209
3 жыл бұрын
Who’s here because of BNGO?
@novaicapital
3 жыл бұрын
Me don't worry it's going to the moon If you invest more than $100 in BNGO you well see you wil be rich in 2-3 years
@LC2460
3 жыл бұрын
Me
@Dinocrap1101
13 жыл бұрын
cool vid
@Trent-tr2nx
9 жыл бұрын
It's pretty cool that in 2015 we live in a world in which you can get your DNA sequenced for $99 instead of the $1000 it estimated in the video. Amazing!
@KoreyKruse
8 жыл бұрын
+Trent Dye DNA cannot be sequenced for $99. There are genetic tests by 23andme.com that provide very limited tests of only certain genes for $199. Whole genotype sequencing is still well over $1000.
@augurelite
13 жыл бұрын
I wanna be a genomist
@chapterchatter
3 жыл бұрын
It’s been 9 years. How’s that going?
@augurelite
3 жыл бұрын
@@chapterchatter HAHA now I'm an aerospace engineer :3
@chapterchatter
3 жыл бұрын
@@augurelite wow, very impressive :) Thanks for the reply
@peepdi
3 жыл бұрын
@@augurelite OMG great.
@Juliana-rw6pt
2 жыл бұрын
whyd u decide to be an aerospace engineer instead?
@muhammadsaleemfazal7765
7 жыл бұрын
nice
@j1der698
4 жыл бұрын
1:44 3D illusion
@seanhunsicker7418
3 жыл бұрын
Anyone here to find out what arkg is about
@christophermartin972
3 жыл бұрын
The guy who made my lawn Gnome is a Gnomist
@THX1146
11 жыл бұрын
I wonder if they thought of making genomic changes with a vaccine. Ask your doctor to read the insert that comes with the bottle.Ask him him if he cares.
@tahirashakeel327
Жыл бұрын
🐢🐳🐳🐳🐚🐚
@anilkumarsharma1205
4 жыл бұрын
put the genome mixing with coconut genome mixing with pumpkin genome mixing with water melon genome mixing with melons genome mixing with mustard oil plants mustard seeds genome mixing with oil production plants genome mixing with rubber plants genome mixing with coconut genome mixing with plum genome mixing with pumpkin genome mixing so we got more edibles and complex compound for fractional distillations and patrol solution become easy forever
Пікірлер: 50